Hematodinium sp (clade B) / Munida rugosa

SYMBIONT

Hematodinium sp (clade B)

Super Group: 
Alveolata
Phylum: 
Dinophyta
Class: 
Syndinea
Order: 
Syndiniales
Family: 
Syndinidae
Genus: 
Hematodinium
Authority: 
Undescribed genetic cluster

HOST

Munida rugosa

Super Group: 
Opisthokonta
Phylum: 
Arthropoda
Class: 
Malacostraca
Order: 
Decapoda
Family: 
Munididae
Genus: 
Munida
Species: 
rugosa
Authority: 
Fabricius 1775

DATA IN REFERENCE

Symbiont genus name in reference: 
Hematodinium sp.
Symbiont identification method: 
ITS1+5.8S+ITS2
Symbiont primer Forward (5'-3'): 
SSU_Hemat-F-1487: cctggctcgatagagttg
Symbiont primer Reverse (5'-3'): 
LSU_ITS4: tcctccgcttattgatatgc
Symbiont Genbank number(s): 
EU096217

DATA IN REFERENCE

Host genus name in reference: 
Munida
Host species name in reference: 
rugosa
Host identification method: 
Morphology