Hematodinium sp (clade B) / Carcinus maenas

SYMBIONT

Hematodinium sp (clade B)

Super Group: 
Alveolata
Phylum: 
Dinophyta
Class: 
Syndinea
Order: 
Syndiniales
Family: 
Syndinidae
Genus: 
Hematodinium
Authority: 
Undescribed genetic cluster

HOST

Carcinus maenas

Super Group: 
Opisthokonta
Phylum: 
Arthropoda
Class: 
Malacostraca
Order: 
Decapoda
Family: 
Carcinidae
Genus: 
Carcinus
Species: 
maenas
Authority: 
Linnaeus 1758

DATA IN REFERENCE

Symbiont genus name in reference: 
Hematodinium sp.
Symbiont identification method: 
ITS1+5.8S+ITS2
Symbiont primer Forward (5'-3'): 
SSU_Hemat-F-1487: cctggctcgatagagttg
Symbiont primer Reverse (5'-3'): 
LSU_ITS4: tcctccgcttattgatatgc
Symbiont Genbank number(s): 
EF675760–EF675762, DQ871210, EU096220–EU096225, FJ648419–FJ648423

DATA IN REFERENCE

Host genus name in reference: 
Carcinus
Host species name in reference: 
maenas
Host identification method: 
Morphology