SYMBIONT

Hematodinium sp (clade B)

Super Group: 
Alveolata
Phylum: 
Dinophyta
Class: 
Syndinea
Order: 
Syndiniales
Family: 
Syndinidae
Genus: 
Hematodinium
Authority: 
Undescribed genetic cluster

HOST

Cancer pagurus

Super Group: 
Opisthokonta
Phylum: 
Arthropoda
Class: 
Malacostraca
Order: 
Decapoda
Family: 
Cancridae
Genus: 
Cancer
Species: 
pagurus
Authority: 
Linnaeus 1758

DATA IN REFERENCE

Symbiont genus name in reference: 
Hematodinium sp.
Symbiont identification method: 
ITS1
Symbiont primer Forward (5'-3'): 
ITS1_Hematodinium: GTTCCCCTTGAA CGAGGAATTC
Symbiont primer Reverse (5'-3'): 
ITS1_Hematodinium; CGCATTTCGCTGCGTTCTTC
Symbiont Genbank number(s): 
EF031993–EF032001

DATA IN REFERENCE

Host genus name in reference: 
Cancer
Host species name in reference: 
pagurus
Host identification method: 
Morphology