Hematodinium perezi (clade A, genotype II) / Scylla paramamosain #3

SYMBIONT

Hematodinium perezi (clade A)

Super Group: 
Alveolata
Phylum: 
Dinophyta
Class: 
Syndinea
Order: 
Syndiniales
Family: 
Syndinidae
Genus: 
Hematodinium
Species: 
perezi
Authority: 
Chatton & Poisson 1931

HOST

Scylla paramamosain

Super Group: 
Opisthokonta
Phylum: 
Arthropoda
Class: 
Malacostraca
Order: 
Decapoda
Family: 
Portunidae
Genus: 
Scylla
Species: 
paramamosain
Authority: 
Keenan, Davie & Mann 1998 (Estampador 1949)

DATA IN REFERENCE

Symbiont genus name in reference: 
Hematodinium sp
Symbiont identification method: 
ITS1
Symbiont primer Forward (5'-3'): 
ITS1_Hematodinium: GTTCCCCTTGAA CGAGGAATTC
Symbiont primer Reverse (5'-3'): 
ITS1_Hematodinium; CGCATTTCGCTGCGTTCTTC

DATA IN REFERENCE

Host genus name in reference: 
Scylla
Host species name in reference: 
serrata
Host identification method: 
Morphology