SYMBIONT

Amoebophrya ceratii-Clade-33

Super Group: 
Alveolata
Phylum: 
Dinophyta
Class: 
Syndinea
Order: 
Syndiniales
Family: 
Amoebophyidae
Genus: 
Amoebophrya
Species: 
ceratii-Clade-33

HOST

Gonyaulax polygramma

Super Group: 
Alveolata
Phylum: 
Dinophyta
Class: 
Dinophyceae
Order: 
Gonyaulacales
Family: 
Gonyaulacaceae
Genus: 
Gonyaulax
Species: 
polygramma
Authority: 
Stein 1883
Synonym(s): 
Gonyaulax schuettii Lemmermann 1899

DATA IN REFERENCE

Symbiont genus name in reference: 
Amoebophrya
Symbiont species name in reference: 
ceratii
Symbiont identification method: 
SSU
Symbiont primer Forward (5'-3'): 
(GTGGTGCATGGCCGTTCTTAGTT)
Symbiont primer Reverse (5'-3'): 
(TCCTCCGCTTATTGATATGC)
Symbiont Genbank number(s): 
AY775285

DATA IN REFERENCE

Host genus name in reference: 
Gonyaulax
Host species name in reference: 
polygramma
Host identification method: 
Morphology