SYMBIONT

Hematodinium sp (clade C?)

Super Group: 
Alveolata
Phylum: 
Dinophyta
Class: 
Syndinea
Order: 
Syndiniales
Family: 
Syndinidae
Genus: 
Hematodinium
Authority: 
Undescribed genetic cluster

HOST

Chionoecetes opilio

Super Group: 
Opisthokonta
Phylum: 
Arthropoda
Class: 
Malacostraca
Order: 
Decapoda
Family: 
Oregoniidae
Genus: 
Chionoecetes
Species: 
opilio
Authority: 
O. Fabricius 1788

DATA IN REFERENCE

Symbiont genus name in reference: 
Hematodinium sp
Symbiont identification method: 
ITS1
Symbiont primer Forward (5'-3'): 
SSU_18SF2: CAGTTTCTGGAAGTGGCAGCTG
SSU_Hemat-F-1487: cctggctcgatagagttg
Symbiont primer Reverse (5'-3'): 
ITS1_ITSR1: GAAGGGAAGGGGAGAAGAAGC
5.8S_Hem3R: TAACCCGAGCCGAGGCATTCA
Symbiont Genbank number(s): 
FJ172642–43

DATA IN REFERENCE

Host genus name in reference: 
Chionoecetes
Host species name in reference: 
opilio
Host identification method: 
Morphology