Hematodinium sp (clade B) / Nephrops norvegicus #4

SYMBIONT

Hematodinium sp (clade B)

Super Group: 
Alveolata
Phylum: 
Dinophyta
Class: 
Syndinea
Order: 
Syndiniales
Family: 
Syndinidae
Genus: 
Hematodinium
Authority: 
Undescribed genetic cluster

HOST

Nephrops norvegicus

Super Group: 
Opisthonkonta
Phylum: 
Arthropoda
Class: 
Malacostraca
Order: 
Decapoda
Family: 
Nephropidae
Genus: 
Nephrops
Species: 
norvegicus
Authority: 
Linnaeus 1758

DATA IN REFERENCE

Symbiont genus name in reference: 
Hematodinium sp.
Symbiont identification method: 
ITS1+5.8S+ITS2
Symbiont primer Forward (5'-3'): 
SSU_Hemat-F-1487: cctggctcgatagagttg
Symbiont primer Reverse (5'-3'): 
LSU_ITS4: tcctccgcttattgatatgc
Symbiont Genbank number(s): 
EU096208, EU096209, EU096215, EU096210, EU096211, EU096214

DATA IN REFERENCE

Host genus name in reference: 
Nephrops
Host species name in reference: 
norvegicus
Host identification method: 
Morphology